snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD95
sequence
TACAGATACAAGACCTCAACATGCCATCTAACTGTGGAGCTGAAAATCCAGAGGCTGTT
TTTGTACTC
  Box motif
  Complementary to target RNA
length 68
organism Mus_musculus
snoRNA name SNORD95
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:141:SNORD95
organization Mono
target RNA 28S rRNA
modification type C/D
modification site 28S:A2568, 28S:C2577
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved