snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA73
sequence
TGAGTATGTTAAATTGAGTGTCAATAAGAATTCCCCAAGAGTGGCTTATGGGAACATAG
GGTTCAGCCCAGTGGTGTACAGTCCCTTTCCACAATGTTGGAGATGAAGCTGGGCTTCGA
GTCTGTGCCTGCATGTTCCTCCGACTTCTCAGAGTCCTGTGGAGGATGACTGAGGAGACA
AATCATGAAGGAAACAGTC
  Box motif
  Complementary to target RNA
length 198
organism Mus_musculus
snoRNA name SNORA73
alias U17b
chromosome ⁄ contig 15
locus ⁄ host gene Mono:243:SNORA73
organization Mono
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved