snOPY snoRNA Orthological Gene Database
Mus_musculus snoZ40
sequence
TGATGTTGTGATGATGGGCAAAAATGTTCAACTGCTCTGAATGGGCTGAATGAAAGTAG
CCTTTCTGAACATCT
  Box motif
  Complementary to target RNA
length 74
organism Mus_musculus
snoRNA name snoZ40
alias
chromosome ⁄ contig 9
locus ⁄ host gene Poly:9:SNORA40
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:G2479
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved