snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA1
sequence
AGCCTCATTGTACATAAGAATGGGCATTGTTGGTCATTGTCCAGAACTGGTCGATGTGG
CTAAATTGAGATACAGGTCATGCTTCCATCACAGCAGATACATTACAGTGGTGACAATGA
GACCTGTAACATTT
  Box motif
  Complementary to target RNA
length 133
organism Mus_musculus
snoRNA name SNORA1
alias ACA1
chromosome ⁄ contig 9
locus ⁄ host gene Poly:9:SNORA40
organization Poly
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4423
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved