snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA43
sequence
GCTGTGCTGGATCTGTCAGGACTGCAGGAACAGCTGCTGGGCTCTGTCTGTGACAATGG
GGCAAAGAGCAAGTGGCTATTTCTCTACTCAGTTTTCAGAAGCCAGTGAGCACTAAGAAT
GGAATATAGCTTGACACTT
  Box motif
  Complementary to target RNA
length 138
organism Mus_musculus
snoRNA name SNORA43
alias ACA43
chromosome ⁄ contig 9
locus ⁄ host gene Mono:343:SNORA43
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4620
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved