snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA58
sequence
GGGCATATCCGTAGACCTTGCTTGACTCTTGTCTGTGGCCAAGCAAGGGGGACAGAGTA
TGCGAGAGTAATTGGAGTTCATGCAAGTTCTAACCAGCTTACTCAGTAGCTGGGTGAATT
GCAGTACTCCAACATTC
  Box motif
  Complementary to target RNA
length 136
organism Mus_musculus
snoRNA name SNORA58
alias ACA58
chromosome ⁄ contig 12
locus ⁄ host gene Mono:413:SNORA58
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 18S:U3500
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved