snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD65
sequence
AAATGATGATATCACCTAAAATAGCTGGAATTACCGGCAGATTGGTAGTGGTGAGCCTA
TGGTTTTCTGAAG
  Box motif
  Complementary to target RNA
length 72
organism Mus_musculus
snoRNA name SNORD65
alias
chromosome ⁄ contig 11
locus ⁄ host gene AV478545
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:U628
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved