snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA29
sequence
CACTGCACATAAAATAAGTTGTTTTCTCTTCTTACTACTAGATATGGTGGTTACATTTA
TGCAGTAGATTAAAATTGCCATGATATGAAGAGAGAGGGCTTTTCGGTGTTCTCTTTCTT
TATAAAATGGCTGGACATACTATC
  Box motif
  Complementary to target RNA
length 143
organism Mus_musculus
snoRNA name SNORA29
alias ACA28
chromosome ⁄ contig 2
locus ⁄ host gene Mono:495:SNORA29
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U816,18S:U867
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved