snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA76
sequence
GCGCTGCCTTTGAGCCCCCGGCCCACCTTCTCGTGGTGCCGGGGGTTAAGCTGCGGCGC
CATAACACTCTGCTAGCGCATAACTGGGGCCGCCTGCCCTTCGCGGGCGGCCCTTTTAAC
CGCTAGCTACAGGC
  Box motif
  Complementary to target RNA
length 133
organism Mus_musculus
snoRNA name SNORA76
alias ACA62
chromosome ⁄ contig 11
locus ⁄ host gene Poly:14:SNORND104
organization Poly
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U34,18S:U105
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved