snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD59
sequence
CTTCCATGATGATTTCTAACTAGATGACTTTCGTTCTTCTGAGTTTGCTGAAGCCATGC
TTAGAATCTGAGCAAG
  Box motif
  Complementary to target RNA
length 75
organism Monodelphis_domestica
snoRNA name SNORD59
alias
chromosome ⁄ contig Un
locus ⁄ host gene Q0QEQ0_MONDO
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved