snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORA23
sequence
CAGCCTTTGTGTGCATAGCTTCCATCTGTGTCTGGTAGCATTGTCTGTTTGTGTTTTGC
ATTCAGATGCTGCTGCCCACACATAATCCTGCAGCCAGAAAGAAAAATGGGATCATAGTA
CTGGCCTAGTGACGTCTTTTTGGACAAATCTAACACTGGTCAGCCTCCGAACTCCCAGAC
ATAT
  Box motif
  Complementary to target RNA
length 183
organism Monodelphis_domestica
snoRNA name SNORA23
alias
chromosome ⁄ contig 5
locus ⁄ host gene IPO7
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved