snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD73
sequence
AATGAATGATGACAAAATGTTTCGGTCCCAAATGATACATAATGATTATACCATTGCAT
TTTTTCTGACATT
  Box motif
  Complementary to target RNA
length 72
organism Monodelphis_domestica
snoRNA name SNORD73
alias
chromosome ⁄ contig 5
locus ⁄ host gene ENSMODG00000000969
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved