snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD15
sequence
CTTCAATGAAGATGCGATGACGAGTCTGACAGGAGGTGTACTCTGTTCAGGTGTTCTAC
TCTGGTTCTGCGTTCTGCAGGCCAGAATTCAGACTCCTGACTTAAAGTCATTTCCTTAAG
AAGATCTAGAGGCATTTGTCTGAGAAGG
  Box motif
  Complementary to target RNA
length 147
organism Monodelphis_domestica
snoRNA name SNORD15
alias
chromosome ⁄ contig 4
locus ⁄ host gene RPS3
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved