snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD58
sequence
CTGCAGTGATGACTTTTCTTAGGACACCTTTGGATTAACAATGAAAATAAAAACAATAC
TGAGCAGC
  Box motif
  Complementary to target RNA
length 67
organism Monodelphis_domestica
snoRNA name SNORD58
alias
chromosome ⁄ contig 3
locus ⁄ host gene ENSMODG00000003534
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved