snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD17
sequence
GTGAAATGATGATGAAGTTTATCCATTCTCTGAGTGTGCTGCTCTGCCCTTCCTACAGC
TCTGAGTTCCTGTTCTAGGAACTCTTGAGTTATGTAACCTCCAGATACCCTCCAGACTTG
CAGTGTTCTACTGTGGATGGCAGGTGTGTGTGGTGGTCTTACTAGTAGGAAGAGATGGAG
TTAGCAGAGGTGAAACCCCATTATTTGGGGTCCCATCTTACCAAGACGAATGACTGGTGT
CTGATCAC
  Box motif
  Complementary to target RNA
length 247
organism Monodelphis_domestica
snoRNA name SNORD17
alias
chromosome ⁄ contig 1
locus ⁄ host gene CSRP2BP
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved