snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORA65
sequence
CCCGCCACTGCACCTGTATCCAGTATTATGTTGGCTGGTGCAATCCAGTGGTGAGCTGA
GAGAAAAACCCAGCTTAGGAAACAGGGTTATTCTGCTTGTGGATGACTCTGTGCCGAAAG
CTTGGGAACAAGG
  Box motif
  Complementary to target RNA
length 132
organism Monodelphis_domestica
snoRNA name SNORA65
alias
chromosome ⁄ contig 1
locus ⁄ host gene ENSMODG00000004571
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved