snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORA38
sequence
ACCTCCCACAAAGGCGTGTCTGTGGCTTCCCATCCATAGATACGTAAGAACTGGAGGCA
AAGAAATGAGGATTAGGAAAAGTTCAAGACTGGCTTACTCAACCCTTGCTGGTCTAGGAC
TTCCTGTCCAACAATA
  Box motif
  Complementary to target RNA
length 135
organism Monodelphis_domestica
snoRNA name SNORA38
alias
chromosome ⁄ contig 2
locus ⁄ host gene BAT2
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved