snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD99
sequence
ACTGGTCAGTGATGAATCTCTTATCTGGTGGACATGCTTTGGATGACACTTGCGGATAT
GGGGCTGAGACCAGTCACAAGC
  Box motif
  Complementary to target RNA
length 81
organism Monodelphis_domestica
snoRNA name SNORD99
alias
chromosome ⁄ contig 4
locus ⁄ host gene Poly:12:SNORD99
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved