snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD52
sequence
GGGAATGATGAGTTTTTCAGACTAGAGTCTCTGACATCTGCCTTGGAGACAAGAAAACC
ACTCTGACCC
  Box motif
  Complementary to target RNA
length 69
organism Monodelphis_domestica
snoRNA name SNORD52
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:5:SNORD48
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved