snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORA56
sequence
AAGCAGACAGTTATCCCTTTCTGGTCTTCCTCTCGTGACCTTAGAGGGAGTCAGTCTGC
AACATGAAGTGATGGCAAGCTGTTTCTGGCCAGCATCACAGTGTGTTGATGGTGGTTTCA
GCCTTGCCAGACACCC
  Box motif
  Complementary to target RNA
length 135
organism Monodelphis_domestica
snoRNA name SNORA56
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:20:SNORA56
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved