snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD43
sequence
TACACGTGATGAAATCTATGACGGGCGGACAGAGAAAACACGTGCTGAACGTCATATTC
TGATGGT
  Box motif
  Complementary to target RNA
length 66
organism Monodelphis_domestica
snoRNA name SNORD43
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:11:SNORD43
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved