snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORA42
sequence
GCATGGCTTTGGATTTATGGAAAATCCATTCAAAACTGGGTTTCTCATAGTGTATTCCA
TGCCAAAGAAATTGACTACCCCCAACCATTGCCGGGCCTGAATCTGTAGGCTTTAGGCAC
TGAAGTGGGTAGGACAGGA
  Box motif
  Complementary to target RNA
length 138
organism Monodelphis_domestica
snoRNA name SNORA42
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:21:SNORA42
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved