snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNORD88
sequence
GGGCTCCCATGATGCCAGCACTGGGCTCTGAGCCTCTGAGGACAAACACGGTGCCCCCC
AGGCCTTTGACTCCTGGGGGTCTGAGGAGCCC
  Box motif
  Complementary to target RNA
length 91
organism Monodelphis_domestica
snoRNA name SNORD88
alias
chromosome ⁄ contig Un
locus ⁄ host gene Mono:23:SNORD88
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved