snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA30
sequence
CTGGCACTTTCATAGGCCCTCCCTCAGGCTTCGGGGCCAGACTTTGGTAGCTGGTGCTG
AGAGAAAACCCTTGATTATATCCTTGCCCTGGGACTGTGCCAGGGGCAGCTGTCACTCAA
TGGGATAATT
  Box motif
  Complementary to target RNA
length 129
organism Microcebus_murinus
snoRNA name SNORA30
alias
chromosome ⁄ contig GeneScaffold_4286
locus ⁄ host gene KIAA1797
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved