snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD73
sequence
AATGAATGATGACAAAATGTTTCGGTCCCAAATGATACATACTGATTATACCGTTACAT
TTATTTCTGACATT
  Box motif
  Complementary to target RNA
length 73
organism Microcebus_murinus
snoRNA name SNORD73
alias
chromosome ⁄ contig GeneScaffold_2408
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved