snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA3
sequence
GCCGAGACTAGAGTCACATCTTGACACCACTCTTGTCCTGGTGTGCTAGAGTTCTCGAA
GAGAATCTGCTGGTCTTGATTCACTGGCGGGGGCAATCAGTGCCCCCATTAGTGCCCAGG
TCAGTAACACAT
  Box motif
  Complementary to target RNA
length 131
organism Microcebus_murinus
snoRNA name SNORA3
alias
chromosome ⁄ contig GeneScaffold_3295
locus ⁄ host gene RPL27A
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved