snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA14
sequence
TTGCATTCTTAAACCCTCTTGGTTGCTTCGCTCTAAACGCTTCCAAGATACGAGTGAAT
GCTATAGAAATTGCAGGGGAGTCCAAAGGGCTGCGCTTCTTCTGTGGCTCAGTCTTATTT
CATACCTGCGACATCT
  Box motif
  Complementary to target RNA
length 135
organism Microcebus_murinus
snoRNA name SNORA14
alias
chromosome ⁄ contig GeneScaffold_3662
locus ⁄ host gene TOMM20
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved