snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA57
sequence
CCTTTTCTTGGCAGGGACTGGGCATGTGGTCCCACTCCCTGCTATGTACAAAGGCAGAG
GGAAAGGGCTCCAGCCCCCTCAGGGTCACGCTGTCAATGTTGGTGGCTTCCCATCTGCTG
GTTCTATCCTCACGTGCTAGGATCCTG
  Box motif
  Complementary to target RNA
length 146
organism Microcebus_murinus
snoRNA name SNORA57
alias
chromosome ⁄ contig GeneScaffold_3831
locus ⁄ host gene SPNS1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved