snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD105
sequence
TGCCCATCTCTTATGATGAAACCGTTTGCCTCTGAGCTGCCATGATTTTGGCTTCAAAG
TAAACGCTCTGAAGAAGAGTCAGGA
  Box motif
  Complementary to target RNA
length 84
organism Microcebus_murinus
snoRNA name SNORD105
alias
chromosome ⁄ contig GeneScaffold_493
locus ⁄ host gene ENSMICG00000006915
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved