snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD111
sequence
AAGCCTAAGTGATGATTCACATTCATGTCTCTTCTCTGATATATTCTTGAAGAAAATTC
GGTGTATCTGATCGGCCT
  Box motif
  Complementary to target RNA
length 77
organism Microcebus_murinus
snoRNA name SNORD111
alias
chromosome ⁄ contig GeneScaffold_2829
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved