snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA66
sequence
GTGCAAACTCGATCACTAGCTCTGCCTGATGTGGCAGAAGCTAAGGGAACCAGATTTGC
TAAAGTAATTATGGTGATAGAAATGTACTAGCCTCAGATGTNN
  Box motif
  Complementary to target RNA
length 102
organism Microcebus_murinus
snoRNA name SNORA66
alias
chromosome ⁄ contig GeneScaffold_4476
locus ⁄ host gene C1orf77
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved