snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD61
sequence
GCTATGATGAATTTGATTGCACTGATCATATGATATGATAACGTATTGTCCTCTAAGAA
GTTCTGAGCTT
  Box motif
  Complementary to target RNA
length 70
organism Microcebus_murinus
snoRNA name SNORD61
alias
chromosome ⁄ contig scaffold_12474
locus ⁄ host gene ENSMICG00000006856
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved