snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD25
sequence
CCTCCTATGATGAGGACCTTGTCACAGACCTGTACTGAGTTCCGTGAGGATAAGTAACT
CTGAGGAGAC
  Box motif
  Complementary to target RNA
length 69
organism Microcebus_murinus
snoRNA name SNORD25
alias
chromosome ⁄ contig scaffold_48762
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved