snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA44
sequence
CAGCATGTTCCCAAGGCCTGTGGCTGGTTGTGGCCACGGGGTCTCCAACTGCATGCGAG
AACAACCTGGAGAGACTTTGACAGCTCGGGTCAGCACAATACCTGCAGCTGCCACTCGCC
TTTCCTATAATC
  Box motif
  Complementary to target RNA
length 131
organism Microcebus_murinus
snoRNA name SNORA44
alias
chromosome ⁄ contig GeneScaffold_4271
locus ⁄ host gene Poly:16:SNORA61
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved