snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA73
sequence
TCAAGAAGTTTTGCTGGGAGGTCACTCTCCCCAGGCTCTGTCCAGGCGGCATAGGGGAG
CATAGGGCTCTGCCCCATGACGTACAGTCCCTTTCCACAACGTTGGAGATAAAGCTGGGC
TTCGTGTCTGCGCCTGCATATTCCTACGACTTCCCAGAGTCCTGTGGACAATGACTGGGG
AGACAAACCATGCAGGAGACAGCT
  Box motif
  Complementary to target RNA
length 203
organism Microcebus_murinus
snoRNA name SNORA73
alias
chromosome ⁄ contig scaffold_17863
locus ⁄ host gene
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved