snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD30
sequence
ATATATGATGACTTACATGGAATCTCGTTCGGCTGATGACTTGGCTGTTGAGAATTGGA
AATCTGATTTTG
  Box motif
  Complementary to target RNA
length 71
organism Microcebus_murinus
snoRNA name SNORD30
alias
chromosome ⁄ contig scaffold_144161
locus ⁄ host gene Poly:1:SNORD22
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved