snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD60
sequence
GGCCATTAGAGAAATGCAAATCAGTGTATGAAAGCCGCATATGCAATCTGATTATTTTG
CAAGACTGAGGCTT
  Box motif
  Complementary to target RNA
length 73
organism Microcebus_murinus
snoRNA name SNORD60
alias
chromosome ⁄ contig scaffold_131682
locus ⁄ host gene Mono:83:SNORD60
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved