snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA43
sequence
GCTGCACTGGTCCTGCCAGCACCACAGGTGTGGCTGCTCTGCTGCACCTGTGACATCGG
GGCAAAGAGAAAGTGGCTATTTCTACGCTCAGTGTTCCGAAACCAGTGAACACTAAGAAT
GGTTTGTAGCCTGACATTT
  Box motif
  Complementary to target RNA
length 138
organism Microcebus_murinus
snoRNA name SNORA43
alias
chromosome ⁄ contig scaffold_55168
locus ⁄ host gene Mono:131:SNORA43
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved