snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA40
sequence
AGCACCTGTGTTTGTTTTTGCTTAACTTATGGACAAAGACAGGTGTAAAAACTAAATCC
TCTTTTGCAACCCAGAACTCATTGTTTGGTATGAGTTTTGATACATATAAGAAGGAACAT
T
  Box motif
  Complementary to target RNA
length 120
organism Microcebus_murinus
snoRNA name SNORA40
alias
chromosome ⁄ contig scaffold_137988
locus ⁄ host gene Mono:118:SNORA40
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved