snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA42
sequence
ACGAGGAACTGAAGTTTAAGAGAGTTCAAGAAGATTGTGGGTCCCATGCTAGAGCAAAC
TGGCCCCGAACCATTGCCTGGCCTGTGCCAGTAGGCTGCTGGCACTGAAGTGGGTTGCAC
AGTG
  Box motif
  Complementary to target RNA
length 123
organism Microcebus_murinus
snoRNA name SNORA42
alias
chromosome ⁄ contig scaffold_1387
locus ⁄ host gene Mono:111:SNORA42
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved