snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA72
sequence
ATGAGACTATTATTACTGTTCTGGTTTTCTAATAATCAGGACAGGCTAAACATTTACTA
CGTTAAGACCATGCATGTGTCTCCAGAAATCGTTCTTTTCCTAGGTTTAGTTTTATAAAT
GATGGTGATAAAC
  Box motif
  Complementary to target RNA
length 132
organism Microcebus_murinus
snoRNA name SNORA72
alias
chromosome ⁄ contig scaffold_5591
locus ⁄ host gene Mono:153:SNORA72
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved