snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA68
sequence
TCGTTTTTGGTCACCCAGATTGATAAATGTGAACAACGTTTGTCAATACTTTCTTCAAA
ATGTCTCTTGAAGAATCCCATCACCTTTGGGGAGCTGTGGCAGGCCCCTCAAAGTGAATT
TGGAGGTTCTACACCA
  Box motif
  Complementary to target RNA
length 135
organism Microcebus_murinus
snoRNA name SNORA68
alias
chromosome ⁄ contig scaffold_657
locus ⁄ host gene Mono:14:SNORA68
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved