snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD113
sequence
TGGACCGATGATGACTACTGGTGGCGTATGAGTCGTACGATGACTACGTCTGTAATCTG
AGGTCGAT
  Box motif
  Complementary to target RNA
length 67
organism Microcebus_murinus
snoRNA name SNORD113
alias
chromosome ⁄ contig scaffold_41419
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved