snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD88
sequence
GGGCCTCCATGATGTCCAGCACTGGGCTCTGATCCCCACTGAGGACACTGTGCCCTCTG
GGACTTTGACACTCAGGGGTCTGAGAGGCCC
  Box motif
  Complementary to target RNA
length 90
organism Microcebus_murinus
snoRNA name SNORD88
alias
chromosome ⁄ contig scaffold_7735
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved