snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORA8
sequence
TGCACTGCATGGTATCTGCATTCAGCAGTTTACTCCTGCTGGGGTGTTCAAAGGTCAGT
GCCATAGAAATTCAGTATCTGGCATCGTTGGTTTTCTTGGCTTTGTGCATGTTAAACCTG
GTATTTCTATTGATACAGTA
  Box motif
  Complementary to target RNA
length 139
organism Microcebus_murinus
snoRNA name SNORA8
alias
chromosome ⁄ contig scaffold_2279
locus ⁄ host gene
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved