snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD81
sequence
ACAAATCCATGATGATCTCGCCTCAGTTTGAACTCTCTCACTGATTACTTGATGACAAT
AAAAGATCTGATATT
  Box motif
  Complementary to target RNA
length 74
organism Microcebus_murinus
snoRNA name SNORD81
alias
chromosome ⁄ contig GeneScaffold_975
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved