snOPY snoRNA Orthological Gene Database
Microcebus_murinus SNORD58
sequence
CTGCGATGATGGTATTTCTTAGGACACCTTTGGATTAATCATGAAACACTACTCTCTGA
GCAGC
  Box motif
  Complementary to target RNA
length 64
organism Microcebus_murinus
snoRNA name SNORD58
alias
chromosome ⁄ contig GeneScaffold_3802
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved