snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA31
sequence
CTGCATCCACTGATAGACCTTGAACAATTTACTGTTGTTCTTTTGGTTTGCACTAGGAT
GCAAAAGAAAAATCCCTGCGCTTTCTGTCTGTCTTTGTGGCGGCCCAGATTGAATTGGGG
AATACATCT
  Box motif
  Complementary to target RNA
length 128
organism Macaca_mulatta
snoRNA name SNORA31
alias
chromosome ⁄ contig 17
locus ⁄ host gene TPT1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved