snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORD58
sequence
CTGCGGTGATGACTTTCTTAGGACACCTTTGGATTTACCGTGAAAATTAATAAATTCTG
AGCGGC
  Box motif
  Complementary to target RNA
length 65
organism Macaca_mulatta
snoRNA name SNORD58
alias
chromosome ⁄ contig 18
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved