snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORD36
sequence
TTGCCAGTGATGGTTAAGAATTTCTTCACCTGAATAAACCATGTGGTCGACATTGTATC
TGAGGCAAA
  Box motif
  Complementary to target RNA
length 68
organism Macaca_mulatta
snoRNA name SNORD36
alias
chromosome ⁄ contig 15
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved